File References.embl-gh.fasta
This file contains dereplicated sequences extracted from the EMBL nucleic database release 107 using the ecopcr programm.
The sequences have been extracted using the ITS-F primer:       GATATCCGTTGCCGAGAGTC .
                                        and ITS1Poa-R primer:   CCGAAGGCGTCAAGGAACAC .
Data collection:
Eric Coissac: run the ecoPCR program
Contact author: 
Pierre Taberlet (pierre.taberlet@ujf-grenoble.fr)
The header of each sequence contains:
    (i) the ID for the sequence
    (ii) the ncbi taxon identifier (taxid)
    (iii) the scientific name of the correponding taxon (scientific_name)
    (iv) the taxonomic rank of ncbi taxid (taxonomic_rank)
    (v) optionnaly if rank=group; the list of merged taxa