File References.embl-gh.fasta This file contains dereplicated sequences extracted from the EMBL nucleic database release 107 using the ecopcr programm. The sequences have been extracted using the ITS-F primer: GATATCCGTTGCCGAGAGTC . and ITS1Ast-R primer: CGGCACGGCATGTGCCAAGG. Data collection: Eric Coissac: run the ecoPCR program Contact author: Pierre Taberlet (pierre.taberlet@ujf-grenoble.fr) The header of each sequence contains: (i) the ID for the sequence (ii) the ncbi taxon identifier (taxid) (iii) the scientific name of the correponding taxon (scientific_name) (iv) the taxonomic rank of ncbi taxid (taxonomic_rank) (v) optionnaly if rank=group; the list of merged taxa