File references.arctic-ITSCyp.fasta This file contains the sequences produced by the ITS1-F (GATATCCGTTGCCGAGAGTC) and ITS1Cyp-R (GGATGACGCCAAGGAACAC) primers The sequences have been produced by the Roche 454 GS FLX platform. Data collection: Reidar Elven identified the specimen. Anne Krag Brysting, Reidar Elven, Jorn Henrik Sonstebo collected tissues in the herbarium. Virginia Mirre, Jorn Henrik Sonstebo, Julie Sannier extracted DNA. Delphine Rioux, Ludovic Gielly amplified DNA Delphine Rioux, Ludovic Gielly sequenced DNA and check the sequences. Contact author: Pierre Taberlet (pierre.taberlet@ujf-grenoble.fr) The header of each sequence contains: (i) the ID for the sequence (ii) the scientific name of the correponding taxon (scientific_name) (iii) the taxonomic rank of ncbi taxid (taxonomic_rank) (iv) the ncbi taxon identifier (taxid) (v) optionnaly if rank=group; the list of merged taxa